crispr cas9 sgrna ko mouse metabolism library Search Results


p8107s cas9 nuclease neb  (New England Biolabs)
99
New England Biolabs p8107s cas9 nuclease neb
P8107s Cas9 Nuclease Neb, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+cas9+sgrna+ko+mouse+metabolism+library/pm33421369-416-210-213?v=New+England+Biolabs
Average 99 stars, based on 1 article reviews
p8107s cas9 nuclease neb - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier
prs316 tef1p cas9 cyc1t snr52p pac3846 pcas9 plasmid  (Addgene inc)
91
Addgene inc prs316 tef1p cas9 cyc1t snr52p pac3846 pcas9 plasmid
Prs316 Tef1p Cas9 Cyc1t Snr52p Pac3846 Pcas9 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+cas9+sgrna+ko+mouse+metabolism+library/med_rxiv__2023__10__24__23297197-156-1-16?v=Addgene+inc
Average 91 stars, based on 1 article reviews
prs316 tef1p cas9 cyc1t snr52p pac3846 pcas9 plasmid - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier
monoclonal mouse anti cas9 antibody  (Danaher Inc)
99
Danaher Inc monoclonal mouse anti cas9 antibody
A. Schematic diagram of CRISPRi system in Enterococcus faecalis. A two-plasmid system consisting of a small (3,182 kb) vector, pGCP123, for sgRNA expression and a 12,621kb plasmid, pMSP3545-dCas9 Str , for dCas9 Str expression. The sgRNA and dCas9 Str are expressed from a nisin-inducible promoter nisA that is activated upon addition of nisin to the media through the NisKR two-component system encoded on pMSP3545-dCas9 Str . The assembled sgRNA-dCas9 complex blocks gene transcription by binding to DNA and blocking RNA polymerase. Image created with BioRender.com. B. Western blot with <t>anti-Cas9</t> Str antibody on induced EF dCas9 pMSP3545 (empty vector) and EF dCas9 pMSP3545-dCas9 Str at nisin concentration 0-500 ng/ml.
Monoclonal Mouse Anti Cas9 Antibody, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+cas9+sgrna+ko+mouse+metabolism+library/bio_rxiv__2020__04__30__071571-71-5-9?v=Danaher+Inc
Average 99 stars, based on 1 article reviews
monoclonal mouse anti cas9 antibody - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier
anti pdgfrβ  (Santa Cruz Biotechnology)
93
Santa Cruz Biotechnology anti pdgfrβ
A. Schematic diagram of CRISPRi system in Enterococcus faecalis. A two-plasmid system consisting of a small (3,182 kb) vector, pGCP123, for sgRNA expression and a 12,621kb plasmid, pMSP3545-dCas9 Str , for dCas9 Str expression. The sgRNA and dCas9 Str are expressed from a nisin-inducible promoter nisA that is activated upon addition of nisin to the media through the NisKR two-component system encoded on pMSP3545-dCas9 Str . The assembled sgRNA-dCas9 complex blocks gene transcription by binding to DNA and blocking RNA polymerase. Image created with BioRender.com. B. Western blot with <t>anti-Cas9</t> Str antibody on induced EF dCas9 pMSP3545 (empty vector) and EF dCas9 pMSP3545-dCas9 Str at nisin concentration 0-500 ng/ml.
Anti Pdgfrβ, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+cas9+sgrna+ko+mouse+metabolism+library/bio_rxiv__157750-199-24-69?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
anti pdgfrβ - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier
crispr cas9 mediated genome engineering  (Cyagen Biosciences)
96
Cyagen Biosciences crispr cas9 mediated genome engineering
A. Schematic diagram of CRISPRi system in Enterococcus faecalis. A two-plasmid system consisting of a small (3,182 kb) vector, pGCP123, for sgRNA expression and a 12,621kb plasmid, pMSP3545-dCas9 Str , for dCas9 Str expression. The sgRNA and dCas9 Str are expressed from a nisin-inducible promoter nisA that is activated upon addition of nisin to the media through the NisKR two-component system encoded on pMSP3545-dCas9 Str . The assembled sgRNA-dCas9 complex blocks gene transcription by binding to DNA and blocking RNA polymerase. Image created with BioRender.com. B. Western blot with <t>anti-Cas9</t> Str antibody on induced EF dCas9 pMSP3545 (empty vector) and EF dCas9 pMSP3545-dCas9 Str at nisin concentration 0-500 ng/ml.
Crispr Cas9 Mediated Genome Engineering, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+cas9+sgrna+ko+mouse+metabolism+library/bio_rxiv__64898__2025__12__04__692469-170-12-15?v=Cyagen+Biosciences
Average 96 stars, based on 1 article reviews
crispr cas9 mediated genome engineering - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier
cas9 activity  (Addgene inc)
96
Addgene inc cas9 activity
A. Schematic diagram of CRISPRi system in Enterococcus faecalis. A two-plasmid system consisting of a small (3,182 kb) vector, pGCP123, for sgRNA expression and a 12,621kb plasmid, pMSP3545-dCas9 Str , for dCas9 Str expression. The sgRNA and dCas9 Str are expressed from a nisin-inducible promoter nisA that is activated upon addition of nisin to the media through the NisKR two-component system encoded on pMSP3545-dCas9 Str . The assembled sgRNA-dCas9 complex blocks gene transcription by binding to DNA and blocking RNA polymerase. Image created with BioRender.com. B. Western blot with <t>anti-Cas9</t> Str antibody on induced EF dCas9 pMSP3545 (empty vector) and EF dCas9 pMSP3545-dCas9 Str at nisin concentration 0-500 ng/ml.
Cas9 Activity, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+cas9+sgrna+ko+mouse+metabolism+library/pmc08897436-349-46-23?v=Addgene+inc
Average 96 stars, based on 1 article reviews
cas9 activity - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier
crispr cas9 knockout shrnas against human rab27a  (Addgene inc)
93
Addgene inc crispr cas9 knockout shrnas against human rab27a
Figure 7. Targeting <t>Rab27a</t> by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).
Crispr Cas9 Knockout Shrnas Against Human Rab27a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+cas9+sgrna+ko+mouse+metabolism+library/pm37805922-233-32-61?v=Addgene+inc
Average 93 stars, based on 1 article reviews
crispr cas9 knockout shrnas against human rab27a - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier
cas9 p2aegfp orf  (Addgene inc)
93
Addgene inc cas9 p2aegfp orf
Figure 7. Targeting <t>Rab27a</t> by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).
Cas9 P2aegfp Orf, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+cas9+sgrna+ko+mouse+metabolism+library/pm37770456-50-37-39?v=Addgene+inc
Average 93 stars, based on 1 article reviews
cas9 p2aegfp orf - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier
plasmid expressing cas9 nuclease  (Addgene inc)
94
Addgene inc plasmid expressing cas9 nuclease
Figure 7. Targeting <t>Rab27a</t> by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).
Plasmid Expressing Cas9 Nuclease, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+cas9+sgrna+ko+mouse+metabolism+library/10__1096_slash_fj__201800756r-71-18-26?v=Addgene+inc
Average 94 stars, based on 1 article reviews
plasmid expressing cas9 nuclease - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier
expression vector for cas9  (Addgene inc)
96
Addgene inc expression vector for cas9
Figure 7. Targeting <t>Rab27a</t> by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).
Expression Vector For Cas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+cas9+sgrna+ko+mouse+metabolism+library/ppr0532418-66-1-11?v=Addgene+inc
Average 96 stars, based on 1 article reviews
expression vector for cas9 - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier
crispr cas9 vector  (Addgene inc)
97
Addgene inc crispr cas9 vector
Figure 7. Targeting <t>Rab27a</t> by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).
Crispr Cas9 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+cas9+sgrna+ko+mouse+metabolism+library/10__1158_slash_2326___6066__cir___22___0260-96-8-11?v=Addgene+inc
Average 97 stars, based on 1 article reviews
crispr cas9 vector - by Bioz Stars, 2026-07
97/100 stars
  Buy from Supplier
cas9 nuclease v3  (Danaher Inc)
96
Danaher Inc cas9 nuclease v3
Figure 7. Targeting <t>Rab27a</t> by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).
Cas9 Nuclease V3, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+cas9+sgrna+ko+mouse+metabolism+library/bio_rxiv__2021__09__16__460522-234-0-3?v=Danaher+Inc
Average 96 stars, based on 1 article reviews
cas9 nuclease v3 - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

Image Search Results


A. Schematic diagram of CRISPRi system in Enterococcus faecalis. A two-plasmid system consisting of a small (3,182 kb) vector, pGCP123, for sgRNA expression and a 12,621kb plasmid, pMSP3545-dCas9 Str , for dCas9 Str expression. The sgRNA and dCas9 Str are expressed from a nisin-inducible promoter nisA that is activated upon addition of nisin to the media through the NisKR two-component system encoded on pMSP3545-dCas9 Str . The assembled sgRNA-dCas9 complex blocks gene transcription by binding to DNA and blocking RNA polymerase. Image created with BioRender.com. B. Western blot with anti-Cas9 Str antibody on induced EF dCas9 pMSP3545 (empty vector) and EF dCas9 pMSP3545-dCas9 Str at nisin concentration 0-500 ng/ml.

Journal: bioRxiv

Article Title: Multiplex CRISPRi-Cas9 silencing of planktonic and stage-specific biofilm genes in Enterococcus faecalis

doi: 10.1101/2020.04.30.071571

Figure Lengend Snippet: A. Schematic diagram of CRISPRi system in Enterococcus faecalis. A two-plasmid system consisting of a small (3,182 kb) vector, pGCP123, for sgRNA expression and a 12,621kb plasmid, pMSP3545-dCas9 Str , for dCas9 Str expression. The sgRNA and dCas9 Str are expressed from a nisin-inducible promoter nisA that is activated upon addition of nisin to the media through the NisKR two-component system encoded on pMSP3545-dCas9 Str . The assembled sgRNA-dCas9 complex blocks gene transcription by binding to DNA and blocking RNA polymerase. Image created with BioRender.com. B. Western blot with anti-Cas9 Str antibody on induced EF dCas9 pMSP3545 (empty vector) and EF dCas9 pMSP3545-dCas9 Str at nisin concentration 0-500 ng/ml.

Article Snippet: Cas9 was detected using a monoclonal mouse anti-Cas9 antibody (Abcam).

Techniques: Plasmid Preparation, Expressing, Binding Assay, Blocking Assay, Western Blot, Concentration Assay

Figure 7. Targeting Rab27a by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).

Journal: Cell reports

Article Title: Upregulation of exosome secretion from tumor-associated macrophages plays a key role in the suppression of anti-tumor immunity.

doi: 10.1016/j.celrep.2023.113224

Figure Lengend Snippet: Figure 7. Targeting Rab27a by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).

Article Snippet: Murine TNF-a: 50-GGTGCCTATGTCTCAGCCTCTT-30 and 50-GCCATAGAA CTGA TGAGAGGGAG-3’; Murine IL-1b: 50- TGGACCTTCCAGGATGAGGACA-3’; Murine IL-6: 50-T ACCACTTCACAAGTCG GAGGC-30 and 50- CTGCAAGTGCATCA TCGTTG TTC-3’; TGF-b: 50-TGATACGCCTGAGTGGCTGTCT-3’; GAPDH: 50-CATCACT GCCACC CAGAAGACTG-30 and 50-ATGCCAGTGAGCTTCCCGTTCAG-3’. shRNA knockdown and CRISPR-Cas9 knockout shRNAs against human RAB27A (NM_004850, GCTGCCAATGGGACAAACATA, CAGGAGAGGTTTCGTAGCTA),96 mouse RAB27A (NM_001301230.1, CGAAACTGGATAA GCCAGCTA, GACAAACATAAGCCACGCGAT), human MADD (NG_029462.1, CCACAAGT ACAAGACGCCAAT, CCTGAAAGTATTTGGGCTAAA), mouse MADD (NM_001177720.1, CCACAAGTACAAGACGCCAAT, CCGCTCATTTATGGCAATGAT) or scrambled shRNA (Addgene, Catalog Number:1864) were co-transfected with viral packaging plasmids to package lentiviral particles using HEK293T cells.

Techniques: Expressing, Clinical Proteomics